93
|
Sino Biological
human il22 / il-22 / interleukin 22 protein Human Il22 / Il 22 / Interleukin 22 Protein, supplied by Sino Biological, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/human il22 / il-22 / interleukin 22 protein/product/Sino Biological Average 93 stars, based on 1 article reviews
human il22 / il-22 / interleukin 22 protein - by Bioz Stars,
2026-03
93/100 stars
|
Buy from Supplier |
94
|
Bio-Techne corporation
recombinant human il-22 protein Recombinant Human Il 22 Protein, supplied by Bio-Techne corporation, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/recombinant human il-22 protein/product/Bio-Techne corporation Average 94 stars, based on 1 article reviews
recombinant human il-22 protein - by Bioz Stars,
2026-03
94/100 stars
|
Buy from Supplier |
90
|
R&D Systems
100 ng/ml of all the interleukins (il-17, il-22, il-29) and interferon gamma (ifn-γ) 100 Ng/Ml Of All The Interleukins (Il 17, Il 22, Il 29) And Interferon Gamma (Ifn γ), supplied by R&D Systems, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/100 ng/ml of all the interleukins (il-17, il-22, il-29) and interferon gamma (ifn-γ)/product/R&D Systems Average 90 stars, based on 1 article reviews
100 ng/ml of all the interleukins (il-17, il-22, il-29) and interferon gamma (ifn-γ) - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
96
|
Bio-Rad
0373 sodium chloride 0373 Sodium Chloride, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/0373 sodium chloride/product/Bio-Rad Average 96 stars, based on 1 article reviews
0373 sodium chloride - by Bioz Stars,
2026-03
96/100 stars
|
Buy from Supplier |
92
|
Taconic Biosciences
mpk il 22 fc Mpk Il 22 Fc, supplied by Taconic Biosciences, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/mpk il 22 fc/product/Taconic Biosciences Average 92 stars, based on 1 article reviews
mpk il 22 fc - by Bioz Stars,
2026-03
92/100 stars
|
Buy from Supplier |
96
|
Miltenyi Biotec
il 21 Il 21, supplied by Miltenyi Biotec, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/il 21/product/Miltenyi Biotec Average 96 stars, based on 1 article reviews
il 21 - by Bioz Stars,
2026-03
96/100 stars
|
Buy from Supplier |
90
|
Boster Bio
paired antibody elisa kits Paired Antibody Elisa Kits, supplied by Boster Bio, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/paired antibody elisa kits/product/Boster Bio Average 90 stars, based on 1 article reviews
paired antibody elisa kits - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
86
|
Danaher Inc
resource source identifier il 22 forward primer atgagtttttcccttatggggac idt Resource Source Identifier Il 22 Forward Primer Atgagtttttcccttatggggac Idt, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/resource source identifier il 22 forward primer atgagtttttcccttatggggac idt/product/Danaher Inc Average 86 stars, based on 1 article reviews
resource source identifier il 22 forward primer atgagtttttcccttatggggac idt - by Bioz Stars,
2026-03
86/100 stars
|
Buy from Supplier |
90
|
Thermo Fisher
il-22 bv421 Il 22 Bv421, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/il-22 bv421/product/Thermo Fisher Average 90 stars, based on 1 article reviews
il-22 bv421 - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
93
|
Santa Cruz Biotechnology
il 22 Il 22, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/il 22/product/Santa Cruz Biotechnology Average 93 stars, based on 1 article reviews
il 22 - by Bioz Stars,
2026-03
93/100 stars
|
Buy from Supplier |
90
|
PrimerDesign Inc
il-22 primer Il 22 Primer, supplied by PrimerDesign Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/il-22 primer/product/PrimerDesign Inc Average 90 stars, based on 1 article reviews
il-22 primer - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
90
|
Thermo Fisher
il-23 Il 23, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/il-23/product/Thermo Fisher Average 90 stars, based on 1 article reviews
il-23 - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |